Contents

Introduction

DropSynth is a simple, low-cost method to build thousands of genes from microarray-derived oligos in a single reaction. DropSynth was developed in the Kosuri Lab at UCLA. This website provides resources for scientists who wish to use DropSynth to assemble their own gene libraries. The video below provides a summary of how the DropSynth process works.

DropSynth Summary from Calin Plesa on Vimeo.

FAQ

What is DropSynth?
DropSynth is a new gene synthesis method whereby large gene libraries are assembled from microarray-derived oligo libraries within water-in-oil droplets. Previous gene synthesis methods require isolating individual gene assemblies in different reactions, which becomes cost-prohibitive for assembling thousands of genes and requires expensive automation equipment. DropSynth overcomes this barrier by isolating individual assembly reactions in a vortexed emulsion, allowing for the entire gene library to be assembled in one pot.
How does it work?
DropSynth uses a set of barcoded beads, such that each bead pulls down the required oligos for a particular gene’s assembly. The beads are then emulsified, thereby isolating and concentrating the oligos into a picoliter-sized droplet. Then the barcodes are removed, and gene assembly takes place inside of those droplets by polymerase chain assembly (basically PCR). We then break the emulsion and recover our library of assembled genes.
How does it work in more detail?
A visual description of DropSynth can be seen in the video above. Briefly, the genes to be synthesized are first bioinformatically split into several fragments, such that each fragment can fit on an oligo. Restriction sites and a microbead barcode are added to each oligo. All of the oligos needed to assemble one particular gene are given the same microbead barcode. Typically, the library is split into batches of 384 genes, each with a unique pair of sub-pool amplification primers. After the oligo design is completed, the library is ordered from a commercial oligo pool vendor. Upon arrival, each sub-pool is PCR amplified from the pool with a biotinylated primer. The amplified oligos are then digested at high-temperature to expose the microbead barcode as a single-stranded DNA overhang. Streptavidin-coated beads bind and remove the small biotinylated fragment from the digestion. Processed oligos are mixed with a pool of 384 barcoded microbeads, with each microbead containing only one complementary barcode sequence. Complementary oligos hybridize and are ligated to the microbeads. Any excess or unbound oligos are washed away. The loaded beads are then mixed with PCR reagents, a restriction enzyme and some fluorinated oil. This mixture is then vortexed for several minutes to form a water-in-oil emulsion, which is placed into a thermocycler where the restriction enzyme displaces the oligos from the bead and the gene assembly reaction takes place inside the droplets. Upon completion, the aqueous solution containing the assembled genes is recovered from the emulsion and PCR-amplified again for downstream applications.
What can you build with DropSynth and what are the limitations?
We show in the paper that we can build thousands of genes of length ~450-675bp. It’s likely you can build longer genes, but the limitation is the error rate. Because oligos coming off an array have large error rates (only 50% or so are perfect), assembly of 4 or 5 oligos leads to a maximal rate of perfect synthesis of ~1-5%. The more oligos you use to build a gene, the less likely they it is to be perfect. Gene synthesis companies that use microarray-derived oligos often use enzymatic error correction to get passed these errors, but is difficult to do within the droplets (though we are working on it). Thus, DropSynth is suited for applications where the error rate isn’t as important, for example when you have a multiplexed functional assay or are doing a selection.
Why did you develop DropSynth?
It is difficult to reduce costs of gene synthesis below their current costs of a few cents a base. If you want access to much larger libraries of DNA to characterize that would be currently cost-prohibitive for an individual lab to do; e.g., all promoters of many yeast species, or tens of thousand synthetic gene designs, or genetic variants of thousands of human exons, or in our current example thousands of homologs of a protein from across the tree of life. In the Kosuri lab, we do this a lot as we have developed many methods to characterize large libraries of genes in multiplex for sequences controlling transcription, translation, splicing, and gene function (this work). Right now, what limits these approaches is the length of oligo libraries to input into these functional assays.
How much does it cost?
The initial outlay is primarily in making the barcoded microbeads. In our hands, this costs around $3400 to create a pool of 384 barcoded microbeads, sufficient for around 200 DropSynth reactions (¢4 per gene). The costs of the oligos and other reagents required are about $1-$2 per gene, and are shown in Table S4 of our publication.
What is it useful for?
Since assembled gene libraries are pooled together, DropSynth-generated libraries are particularly useful as an input to multiplex assays, where many DNA encoded hypotheses are barcoded and tested together. In addition, since error rates are high, the method is useful when your screening methodology is very cheap, so you can screen 10-100x more variants than your library size. High-throughput sequencing is then used to evaluate each hypothesis by tracking the relative proportion of each barcode after exposure to some functional screening.
What is it not useful for?
Given their pooled nature, DropSynth libraries are less useful if each gene must be recovered and individually tested. Although we show we can use techniques like Dial-Out PCR to recover individual genes using the barcoded plasmids, extracting each gene out of a DropSynth pool would require significant investment in robotic automation to get large libraries of perfect constructs.
What are the error rates?
Error rates are primarily dependent on the oligo source, number of oligos in the assembly, and the polymerase used. We typically see a median of 2% to 4% perfect assemblies for 4-5 oligo assemblies using the Kapa Robust polymerase.
Where can I get DropSynth reagents?
All DropSynth reagents can be obtained through major suppliers. Microarray-derived oligo pools can be purchased from Agilent Technologies, Twist Bioscience or CustomArray, Inc. Primers used in sub-pool amplification and assembly can be obtained from IDT, DNA polymerases can be obtained from KAPA Biosystems, and restriction enzymes can be obtained from NEB. We are currently exploring avenues to make our pool of 384 DropSynth microbeads available to the scientific community. As of now, these microbeads can be generated using Protocol 1 (above), and can be used for up to 200 pooled assembly reactions before being depleted.

Sequences

Orthogonal primer pairs:
  1. Amplification primers (15-mers): skpp15-forward.faa and skpp15-reverse.faa
  2. Assembly primers (20-mers): forward_finalprimers.fasta and reverse_finalprimers.fasta
Microbead barcode sequences (just 12 nt barcodes): filt_prim_12nt_Lev_3_Tm_40_42_GC_45_55_SD_2_mod_restriction_384.fasta

Microbead sequences:

  1. Ligation oligo (skpp511Frc): 3' biotin - TCCGCGAGTAAACCTAACAA - 5' phosphorylation
  2. Anchor oligo (skpp511F+R): TTGTTAGGTTTACTCGCGGAACACGTGCTATTAGATGCCT - 5' dual biotin
  3. 384X microbead barcoded oligos: bcoligo_cp12mer_384.csv

Data

Mapping data of barcoded DropSynth assembled genes for the DHFR and PPAT libraries described in the publication can be found in NIH Sequence Read Archive under accession id SRP126669.

Discussion

We've created a Google Group to facilitate discussions among scientists using DropSynth in their work.